Survival analysis

We evaluated the effects of AHNAK2 on the survival prognosis of CRC patients using data from The Cancer Genome Atlas (TCGA) via the Gene Expression Profiling Interactive Analysis (GEPIA) database (http://gepia.cancer-pku.cn/detail.php?gene=AHNAK2). Additionally, we utilized the Kaplan–Meier plotter (https://kmplot.com) to assess survival prognosis in CRC by selecting either overall survival or recurrence-free survival endpoints and incorporating all available chemotherapy options.

Clinical samples

After obtaining written informed consent, we collected 59 CRC tissue samples and matched adjacent tissues (as controls). Based on predefined patient selection criteria—confirmed CRC diagnosis via postoperative pathological examination and treatment limited to 5-FU-based chemotherapy—we divided the 59 CRC samples into two groups: (1) 5-FU-resistant cases (n = 30):​​ Defined as patients who exhibited disease progression during postoperative chemotherapy or experienced recurrence within six months after initial treatment; (2) 5-FU-sensitive cases (n = 29):​​ Defined as patients with either recurrence occurring more than six months after primary chemotherapy or no recurrence. All procedures involving human participants were conducted in accordance with the Declaration of Helsinki. The study protocol was approved by the Institutional Review Board of Xijing Hospital of Digestive Diseases (Approval No: KY20232232-C-1, Shaanxi, China).

Immunohistochemical staining

Immunohistochemical staining was performed following a standard protocol [18]. Briefly, tissue samples were fixed in 10% formalin, paraffin-embedded, and sectioned into 5-μm thick slices. The sections were deparaffinized with xylene and rehydrated through a graded ethanol series followed by distilled water. Antigen retrieval was carried out using citrate buffer, after which the sections were incubated overnight at 4 °C with a primary antibody against AHNAK2 (1:500, ab224055, Abcam). Next, sections were incubated with a goat anti-rabbit IgG secondary antibody for 2 h at room temperature. Staining was developed using a diaminobenzidine (DAB) peroxidase substrate kit, and nuclei were counterstained with hematoxylin. After dehydration in graded ethanol, the stained sections were evaluated independently by two blinded pathologists using a light microscope (Olympus, Tokyo, Japan) and analyzed quantitatively with ImageJ 1.8.0 software.

Cell lines

Two human CRC cell lines, LoVo (CCL-229) and HCT116 (CRL-3487) were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA), along with normal colonic epithelial NCM460 cells from Bowers Type Culture Collection (NCM460, BTCC, Beijing, China). These cells were cultured in DMEM (Gibco, Grand Island, New York) supplemented with 10% FBS (Gibco) and incubated at 37 °C in a 5% CO2 atmosphere. To establish 5-FU-resistant sublines (LoVo/5-FU and HCT116/5-FU), parental cells were progressively exposed to escalating 5-FU concentrations (0, 5, 10, 20, 40 and 80 μg/ml). Following dose escalation, resistant cells were maintained in medium containing 80% of the half-maximal inhibitory concentration (IC50) of 5-FU for two weeks to sustain their drug-resistant phenotype.

Drug sensitivity assay

Drug sensitivity was assessed using the Cell Counting Kit-8 (CCK-8) assay (Dojindo Laboratories, Tokyo, Japan) following the manufacturer’s instructions. The CRC cells were seeded (1 × 104 cells per well) in triplicate into 96-well plates. After treated with various dilutions (0, 5, 10, 20, 40 and 80 μg/ml) of 5-FU (Sigma‐Aldrich) for 24 h, 20 μl of CCK-8 reagent was added to each well, and the cells were then incubated for 2 h at 37 °C. Cell viability and the IC50 value were determined based on the absorbance measured at 450 nm using a microplate reader (Bio-Rad Laboratories). This experiment was independently performed three times.

Cell transfection

Lentiviral vectors carrying the short hairpin RNA against human AHNAK2 (shAHNAK2: 5′‐GGGATCAGCTGCTCAGTACAA‐3′) or the negative control (shNC: 5′‐GGTGCTCGTCGAAACAAGTCA‐3′) were generated by Gene Pharma Corporation (Shanghai, China). For AHNAK2 overexpression, human AHNAK2 cDNA or a negative control sequence was cloned into lentiviral vectors to generate LvAHNAK2 and LvNC, respectively, also by Gene Pharma Corporation (Shanghai, China). In cell transfections, LoVo/5-FU and HCT116/5-FU cells were transfected with shAHNAK2, shNC, LvAHNAK2, or LvNC (2.0 µg per well) using Lipofectamine™ 3000 (Invitrogen, Carlsbad, CA, USA) for 48 h. Selection for stable transfection was carried out using 2 µg/ml puromycin.

Colony formation assay

Transfected cells were seeded into six-well plates at a density of 500 cells per well and cultured for 14 days to allow colony formation. Colonies were fixed with 4% paraformaldehyde (Sigma-Aldrich) for 1 h at room temperature, then stained with 0.5% crystal violet for 20 min. Colonies containing ≥ 50 cells were defined as colony-forming unit, imaged, and quantified. The experiment was repeated three times independently.

Flow cytometry analysis

For cell cycle analysis, transfected cells (1.0 × 106) were harvested, washed with PBS, and fixed in 70% ethanol for 12 h at − 20 °C. After fixation, cells were centrifuged at 10,000 × g for 10 min and stained with 50 µg/mL propidium iodide (PI; Sigma-Aldrich, USA) for 30 min in the dark. In the cell apoptosis assay, transfected cells (5.0 × 105) were washed, resuspended in 500 μL binding buffer, and stained with 10 μL Annexin V-FITC and 5 μL PI (KeyGEN Biotech, Nanjing, China) for 15 min at room temperature in the dark). For both assays, cell cycle distribution and apoptosis rates were analyzed using a FACScan flow cytometer (BD Biosciences, San Jose, CA, USA). All experiments were repeated three times independently.

Wound healing assay

Transfected cells (2 × 106 per well) were seeded in six-well culture plates and cultured for 12 h until reaching approximately 90% confluence. The medium was then aspirated, and a uniform wound was created in the cell monolayer using a sterile 200-μL pipette tip. Cells were gently washed with PBS and maintained in serum-free medium. Wound areas were imaged at baseline (0 h, W0) and 24 h (W24) using a light microscope (Nikon Corporation, Tokyo, Japan). The relative wound healing rate was calculated as: Relative migration distance (%) = (W0-W24)/W0 × 100%. Experiments were repeated three times independently.

Transwell assay

Transfected cells (2 × 104) were suspended in 100 μl serum-free medium and seeded into the upper chamber of a Transwell insert (Corning, Madison, NY, USA). The lower chamber was filled with 600 μl medium containing 10% FBS as a chemoattractant. After 24 h of incubation, cells remaining in the upper chamber were removed by gentle swabbing. Migrated cells on the lower membrane surface were fixed with 4% paraformaldehyde, stained with 0.1% crystal violet, and imaged under an Olympus microscope (Tokyo, Japan). Cells in five random fields per well were counted for quantification. The protocol mirrored the migration assay, except Transwell inserts were pre-coated with Matrigel (Corning) to simulate extracellular matrix invasion.

In vivo xenograft assay

Male BALB/c nude mice (4–5 weeks old) were purchased from HFK Bioscience Co., Ltd. (Beijing, China) and acclimatized under specific-pathogen-free (SPF) conditions for one week. To establish CRC xenograft models, 1.0 × 107 shAHNAK2- or shNC- transfected LoVo/5-FU cells were subcutaneously injected into the right dorsal flank of each mouse. Mice were monitored daily, and tumor volume was measured every 7 days using calipers and calculated as: Tumor volume (mm3) = (length × width2)/2. Starting 7 days post-inoculation, mice received intraperitoneal injections of 5-FU (1.0 mg/kg) every 3 days. On day 35, all mice were euthanized via cervical dislocation under isoflurane anesthesia (5% induction, 1% maintenance). Subcutaneous tumors were excised, weighed, and processed for downstream analysis. All procedures adhered to the ARRIVE guidelines and were approved by the Animal Ethics Committee of Xijing Hospital, Air Force Medical University (Approval No. 250832, Shaanxi, China). Experiments complied with institutional and national guidelines for the care and use of laboratory animals.

Quantitative real time PCR

Total RNA was extracted using Trizol (Cat. #T9424-100 m, Sigma-Aldrich). Subsequently, cDNA synthesis was performed via reverse transcription using the M-MLV Reverse Transcriptase Kit (Promega, USA) according to the manufacturer’s protocol. Quantitative real-time PCR was conducted on a StepOnePlus™ Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) with SYBR Green PCR Master Mix (TaKaRa, Tokyo, Japan). The thermal cycling conditions were as follows: initial denaturation at 95 °C for 10 min, denaturation at 95 °C for 10 s, annealing at 60 °C for 30 s, for a total of 40 cycles. Relative mRNA expression of ​​AHNAK2​​ was normalized to ​​GAPDH​​ and calculated using the 2−ΔΔCt method. Primer sequences were as follows: AHNAK2 Forward, 5′-CCGCGATGTGCGACTG-3′; AHNAK2 Reverse, 5′-GTCCCCTGAATCTCGCTTCC-3′; GAPDH Forward, 5′- GAAGACGGGCGGAGAGAAAC-3′; GAPDH Reverse, 5′- TGGAATTTGCCATGGGTGGA-3′.

Western blot analysis

Protein lysates were prepared using ice-cold RIPA buffer, and protein concentrations were quantified using the BCA assay. Equal amounts of protein (20–50 µg per lane) were resolved on 10–12% SDS-PAGE gels and transferred to PVDF membranes. Membranes were blocked with 5% bovine serum albumin (BSA) in Tris-buffered saline with Tween-20 (TBST) for 2 h at room temperature, then incubated overnight at 4 °C with the following primary antibodies (all from Abcam, Cambridge, USA): AHNAK2 (1:1,000, Cat. #ab224055), PCNA (1:1,000, Cat. #ab92552), CDK4 (1:1,000, Cat. #ab199728), cleaved caspase-3 (1:1,000, Cat. #ab2302), E-cadherin (1:1,000, Cat. #ab40772), GSK-3β/p-GSK-3β (1:1,000, Cat. #ab93926/ab75814), AKT/p-AKT (1:1,000, Cat. #ab8805/ab38449) and GAPDH (1:5,000, Cat. #ab8245. After three TBST washes, membranes were incubated with HRP-conjugated secondary antibodies (1:5,000, Cat. #ab6721) for 2 h at room temperature. Protein bands were visualized using an enhanced chemiluminescence (ECL) detection kit (Beyotime Biotechnology, China) and quantified with ImageJ software.

Statistical analysis

Data are presented as mean ± standard deviation (SD). Statistical analyses were performed using GraphPad Prism 8.0. Differences between two groups were assessed using Student’s t-test, while comparisons involving three or more groups were analyzed by one-way ANOVA followed by Tukey’s post hoc test. A p-value < 0.05 was considered statistically significant.