Animal experiment

All animal experiments and procedures were conducted in accordance with the guidelines and regulations set forth by the Institutional Animal Care and Use Committee of Army Medical University. 6 to 8-week-old C57BL/6 mice were utilized, and they were housed in a facility free from pathogens. To induce mouse model with sciatic nerve denervated, the following procedure was followed: mice were anesthetized with 0.5% (w/v) pentobarbital sodium. A 3 mm incision was made between the ischial tuberosity and the greater trochanter to expose the sciatic nerve located on the deep side of the gluteus maximus. A 5 mm segment of the nerve was excised before any branching occurred. This procedure was repeated on the contralateral side. For the interference experiment involving agomiR-27b-3p and agomiR negative control (agomiR NC) (Cat. No. B06004, GenePharma), they were diluted in DEPC water to the final concentration specified by the manufacturer’s protocol. Following nerve denervation, agomiR-27b-3p and agomiR NC were injected into the tibialis anterior (TA) muscle at a volume of 50 µl per muscle twice a week. TA samples were collected at 1 week, 2 weeks, 3 weeks, and 4 weeks post-denervation, denoted as DEN-1 W, DEN-2 W, DEN-3 W, and DEN-4 W, respectively, for further analysis.

Cell isolation and FACS

FAPs were isolated following a previously documented procedure [29]. Hind limb muscles were obtained from uninjured C57BL/6 mice aged 6–8 weeks, and nerves and fat tissues were carefully excised. The muscles were then cut into approximately 1 mm^3-sized fragments. Collagenase II (Cat. No. C7806, Sigma) was employed to enzymatically digest the minced tissue, which was agitated at 500 rpm using magnetic stirring at 37 °C for 1 h. The resulting muscle suspension was filtered through a 100 μm and 40 μm cell strainer (Cat. No. 431,752 and 431,750, BD Bioscience) to remove any debris. Red blood cell lysis buffer (Cat. No. C3702, BD Bioscience) was utilized to eliminate red blood cells, and the cells were then resuspended in PBS. The cells were incubated with fluorescently-labeled antibodies in the dark at 4 °C for 30 min. The antibodies used included Alexa Fluor 488-CD31 (Cat. No. 160,208, Biolegend), Alexa Fluor 488-CD45 (Cat. No. 160,306, Biolegend), APC-Integrinα7 (Cat. No. FAB3518A, R&D), and APC-Cy7-Sca-1 (Cat. No. 108,126, Biolegend). The stained cells were analyzed using FACSAria III (BD Biosciences, NJ, USA), and the gating strategy was based on CD31-CD45-Integrinα7-Sca-1+ (supplementary Fig.  1a). FAPs from DEN-1 W, DEN-2 W, DEN-3 W, and DEN-4 W were isolated and analyzed following the established protocol.

Cell culture and transfection

Freshly sorted FAPs from uninjured mice and 293T cells specifically utilized for dual luciferase assays were cultured in Dulbecco’s Modified Eagle Medium supplemented with 20% Fetal Bovine Serum (Cat. No. SH30406.05, HyClone) and 1% penicillin-streptomycin (Cat. No. C0222, Biolegend). The experimental timelines commence from the initiation of fresh FAP culture, designated as D0, with subsequent days labeled accordingly (e.g., D2, D3, and so forth). (1) Transfection with agomir-27b-3p or agomiR NC (Cat. No. B06004, GenePharma): On D2, the culture medium of freshly sorted FAPs was refreshed, and recombinant TGF-β protein (Cat. No. 594,509, Biolegend) at a final concentration of 5ng/ml in PBS was introduced to induce differentiation of FAPs into myofibroblasts. On D3, transfection reagent (Cat. No. AD600150, ZETA) was employed to transfect agomir-27b-3p or agomiR NC following the manufacturer’s guidelines. (2) Transfection with small interfering RNA targeting TGF-βR1 (si TGF-βR1) or scRNA custom-made from Sangon Biotech: The transfection procedure and timeline for si TGF-βR1 or scRNA mirrored those of the transfection with agomir-27b-3p or agomiR NC. (3) Transfection with plasmid of high expression TGF-βR1 or empty vector (Cat. No. C05007, GenePharma) in combination with agomir-27b-3p or agomiR NC: On D2, the culture medium of fresh FAPs was refreshed, and the TGF-βR1 plasmid or empty vector was transfected following the manufacturer’s protocol. On D4, agomir-27b-3p or agomiR NC was transfected to establish four distinct experimental groups: TGF-βR1 plasmid (+) agomir-27b-3p (+), TGF-βR1 plasmid (+) agomiR NC (+), vector (+) agomir-27b-3p (+), and vector (+) agomiR NC (+). The transfection reagent utilized was the same as before. (4) Utilization of a smad3 phosphorylation inhibitor: SIS3 (Cat. No. CAS 521984-48-5, targetmol), an inhibitor of smad3 phosphorylation formulated in DMSO, was introduced to freshly sorted FAPs at a final concentration of 4 μm on D2. On D3, the cells were transfected with agomir-27b-3p or agomiR NC as previously described.

Enzyme-linked immunosorbent assay

To quantify the TGF-β concentration in denervated muscles, the TA was harvested and weighed at DEN-1 W, DEN-2 W, and DEN-4 W. Subsequently, the muscle samples were placed in separate Eppendorf (EP) tubes, and 300 µl of sterile PBS was added. The samples underwent sonication on ice using an ultrasonic processor (Q500, QSONICA) for 10 pulses at a power of 40 watts for 3 s each, with a 10-second interval between pulses. Following sonication, the tissue homogenate was centrifuged to collect the supernatant. The concentration of TGF-β1 was determined using an enzyme-linked immunosorbent assay (ELISA) kit for TGF-β1 (Cat. No. DB100C, R&D Systems) according to the provided instructions. The absorbance of the samples was measured three times within 30 min after adding the Stop Solution using a plate reader set to 450 nm. The TGF-β concentration was calculated based on the standard curve generated from the assay and then normalized to the muscle mass (mg).

CCK-8 assay

In the Cell Counting Kit-8 (CCK-8) assay, 1 × 10^4 freshly isolated FAPs from uninjured mice were cultured and transfected with either agomir-27b-3p or agomiR NC following the previously described protocol in a 96-well plate. Subsequently, 10 µL of CCK-8 solution (Cat. No. HY-K0301-5mL, MedChemExpress) was added to each well. The wells containing complete medium and CCK-8 solution served as blank controls. The cells were then incubated in the dark at 37 °C with 5% CO2 for 2 h. After the incubation period, the optical density (OD) values at 450 nm were measured using a multi-function plate reader (Varioskan Flash, Thermo Fisher Scientific, USA). Given that the maximum transfection time with agomir-27b-3p or agomiR NC in FAPs is 72 h, the OD values were assessed at 0 h, 24 h, 48 h, and 72 h.

Dual-luciferase reporter assay

The putative binding site of miR-27b-3p on the wild-type (WT) PDGFRα 3’UTR sequence and TGF-βR1 3’UTR, along with their corresponding mutated sequences (UGACACU), were individually cloned into the pMIR-REPORT Luciferase vector provided by OBIO Scientific Services. Subsequently, 293T cells were co-transfected with either Pmir-REPORT Luciferase-TGF-βR1 3’UTR (WT) or pMIR-REPORT Luciferase-TGF-βR1 3’UTR (MUT), along with agomiR-27b-3p or agomiR NC, for a duration of 48 h following the manufacturer’s protocol. Luciferase activities were quantified using a microplate reader. The dual-luciferase reporter assay conducted for PDGFRα mirrored the experimental setup for TGF-βR1.

Immunohistochemistry, immunocytofluorescence and imaging

For immunohistochemical examination, fresh-frozen muscle tissues were sectioned into 8 μm slices using a cryostat (CM3050S, Leica, Germany). These tissue sections were fixed in 4% paraformaldehyde (PFA) for 5 min, permeabilized in 0.5% Triton X-100 (Cat. No. CS0913, BIOSIC) in PBS for 10 min, and subsequently blocked in a solution of PBS containing 10% normal donkey serum, 3% bovine serum albumin (BSA), and 0.1% Triton X-100 for 1 h at 37 °C. Following this, the sections were incubated overnight at 4 °C with the primary antibody, then washed with PBS and exposed to the secondary antibody tagged with Alexa Fluor™ 555 or 488 for visualization. Post-secondary antibody incubation, the sections underwent further PBS washes and were counterstained with Hoechst33342 (Cat. No. C1026, Beyotime) for nuclear visualization. In the case of immunocytofluorescent analysis, cells cultured on coverslips within a petri dish were rinsed with PBS, fixed in 4% paraformaldehyde (Cat. No. P0099, Beyotime) for 20 min, and processed following a similar protocol as the immunohistochemical analysis. The primary and secondary antibodies utilized were col1 (Cat. No. AF7001, Affinity), donkey polyclonal anti-rabbit IgG linked to Alexa Fluor™ 555 (Cat. No. A32794, Invitrogen), and goat polyclonal anti-rabbit IgG linked to Alexa Fluor™ 488 (Cat. No. A-11,008, Invitrogen).

qRT-PCR analysis

Total RNA was isolated using Trizol (Cat. No. 15,596,026, Invitrogen). Reverse transcription into cDNA was carried out using the PrimeScript™ RT Master Mix (Cat. No. RR036A, Takara) and the miRNA primer set according to the manufacturer’s instructions. qRT-PCR was performed on an ABI 7500 Real-Time PCR system (Applied Biosystems, CA, USA). The reverse transcription protocol for miRNA or mRNA cDNA synthesis included incubation at 26 °C for 40 min, 42 °C for 40 min, 85 °C for 10 min, and preservation at 4 °C; followed by 42 °C for 45 min, 85 °C for 5 min, and preservation at 4 °C. GAPDH was used for mRNA expression normalization. Amplification was carried out using iTaq™ Universal SYBR® Green Supermix (Cat. No. 1,725,124, Bio-Rad) with denaturation at 95 °C, followed by 40 cycles of denaturation at 95 °C for 15 s and annealing at 60 °C for 1 min. Relative expression of the target genes was determined using the 2-ΔΔCq method. Specific primer sequences were as follows: GAPDH (forward: GGTTGTCTCCTGCGACTTCA, reverse: TGGTCCAGGGTTTCTTACTCC), acta2(forward: TCGCTGGTGATGATGCT, reverse: TGGTGATGATGCCGTGT), fibronectin1(FN1) (forward: GACCCTTACACGGTTTCCCA, reverse: TGGCACCATTTAGATGAATCGC), collagen1(col1) (forward: CGATGGATTCCCGTTCGAGT, reverse: GAGGCCTCGGTGGACATTAG), lysyloxidase(lox) (forward: GATTGCCACAAGATTTCCA, reverse: TTCCCTTTCCCTTTCCC), miR-27b-3p (forward: AATGGCGTTCACAGTGGCTAAG, reverse: GTGCAGGGTCCGAGGT).

Western blots

The proteins of FAP were extracted using a lysis mixture composed of protease inhibitor, phosphatase inhibitor (Cat. No. P1010, Beyotime), and RIPA lysis buffer (Cat. No. P0013C, Beyotime) in a ratio of 1:1:25. The cell lysis process was carried out on ice. The protein concentration was quantified using a BCA protein assay kit (Cat. No. P0012S, Beyotime). Subsequently, 30 µg of protein-containing samples were loaded onto a 10% SDS-PAGE gel and transferred to a polyvinylidene difluoride (PVDF) membrane (Cat. No. 1,620,177, Bio-Rad Laboratories). The membrane was blocked with 5% BSA in PBS and then incubated with the primary antibody, which was diluted in 1% BSA, overnight at 4 °C. Following this, the membrane was exposed to an HRP-conjugated secondary antibody, diluted in 1% BSA, for 1 h at room temperature. The signal was visualized using a ChemiDoc Touch Imaging System scanner (Bio-Rad Laboratories, CA, USA). Details of the primary and secondary antibodies utilized: TGF-βR1 primary antibody (Cat. No. AF5374, Affinity), Smad2/3 antibody (Cat. No. AF6367, Affinity), P-smad2/3 antibody (Cat. No. bs-8853R, Bioss), HRP-conjugated Goat Anti-Rabbit IgG (Cat. No. SA00001-2, Proteintech).

Statistical analysis

All data are presented as mean ± SE. Independent samples t-test was used for the comparison between two groups, and one-way analysis of variance (ANOVA) was used for the comparison among more than two groups, and Tukey post hoc test is used for multiple comparisons between groups. Statistical significance was defined as p < .05, *p < .05, **p < .01. Each experiment was repeated at least three times.