Cell Culture

The BV2 mouse microglial cell line was reactivated and grown in DMEM (KeyGEN BioTECH, China) enriched with 10% FBS (Sigma, USA) at 37 °C in a 5% CO₂ environment. The growth medium was refreshed every two days, and the cells were subcultured every 48 h.

Experimental Animals

Male C57BL/6 mice, aged 8 to 9 weeks and weighing 18 to 22 g, were sourced from the Nanjing Qinglongshan Animal Breeding Center. The mice were kept in a sterile setting with regulated temperature and humidity, following a 12-h light and dark cycle. The animals were handled and treated in accordance with ethical standards, and the mice had unrestricted access to both water and food.

Establishment of TBI Model

Mice were used for TBI research, and the experimental protocol was approved by the Institutional Animal Care and Use Committee. TBI was induced using the fluid percussion injury (FPI) model (AmScien Instruments, Richmond, Virginia, USA) [36, 37]. Anesthetization of the mice was achieved with isoflurane, maintaining a level that ensured the absence of nociceptive reflexes (such as the toe pinch reflex). After administering anesthesia, the mice were positioned in a stereotaxic frame to stabilize the head. The surgical area was sterilized using a solution of 70% ethanol and povidone-iodine. A 3 mm craniotomy was then performed on the left hemisphere of the mouse brain, 2 mm lateral to the sagittal suture and 3 mm anterior to the bregma, using a high-speed drill while taking care to avoid injuring the dura mater. Following the craniotomy, a luer-lock connector was securely attached to the skull using dental cement and connected to the FPI device. A moderate fluid percussion injury was administered at a pressure of 2.0 ± 0.2 atm, with an impact duration of less than 20 ms. After the injury, the cranial defect was sealed with bone wax, and the incision was sutured closed. The mice were then moved to a temperature-controlled recovery room for post-operative recovery. Recovery was monitored by observing reflex responses and assessing the modified neurological severity score (mNSS). The procedure was repeated three times to ensure the establishment of a moderate TBI injury. The mice were allocated at random into four different groups: Sham, TBI, TBI + Vehicle (administered with dimethylsulfoxide [DMSO] mixed with corn oil), and TBI + DMC (administered with 100 mg/kg DMC via gavage post-injury).

Modified Mouse Neurological Function Score (mNSS Score)

Neurofunction was evaluated using the modified neurological severity score (mNSS) at 24, 48, and 72 h post-TBI. The mNSS scoring system assessed motor, sensory, reflex, and balance functions, as well as any abnormalities. Motor function was assessed through tail suspension and the observation of spontaneous movements to monitor the muscle condition and overall impairment of motor function. Sensory function was evaluated by tactile and nociceptive tests, measuring the mice’s ability to respond to stimuli. Reflexes and balance were examined through corneal reflex, pinna reflex, righting reflex, and beam walking, assessing the integrity of the reflex arc, posture control, and motor coordination. Abnormal behaviors were observed by noting involuntary movements and the mice’s responsiveness to environmental stimuli, providing insight into the state of the motor control centers and the level of alertness and consciousness. The scale spans from 0 to 18, where elevated values correlate with increased levels of neurological dysfunction. A zero score signifies typical functionality, while scores of 1–6 suggest slight decline, 7–12 denote moderate decline, and 13–18 indicate significant decline in neurological capabilities.

Brain Water Content Measurement

To evaluate cerebral swelling, the water content in the brain was determined using the wet-dry weight technique. Brain tissue was carefully dried with filter paper, and the wet weight was recorded. The sample was subsequently dehydrated in an oven at 90 °C for 72 h to ascertain the dry mass. The calculation for brain water content is as follows: (weight before drying—weight after drying) / weight before drying × 100%. Elevated percentages suggest increased edema severity.

Morris Water Maze (MWM)

The Morris Water Maze assessment was employed to assess cognitive abilities following DMC therapy. The setup included a circular pool measuring 120 cm in diameter, featuring a submerged platform with a diameter of 8 cm. The water temperature was kept between 20–22 °C and colored with alum. Mice participated in four days of training, during which the duration needed to locate the platform (escape latency) was measured. After the FPI injury, the Sham, TBI, and DMC-treated groups were tested for three consecutive days. At the end of the experiment, the platform was taken out, and the duration spent in the designated quadrant (within 60 s) was documented. The percentage of time spent was computed as follows: (time in the designated quadrant/60) × 100%.

Cell Viability Assay (CCK-8)

BV2 microglial cells were cultured in 96-well plates at a density ranging from 3000 to 5000 cells per well. After adherence, lipopolysaccharide (LPS) and DMC were added at various concentrations. The CCK-8 reagent (Beyotime Biotechnology, China) was combined with DMEM containing 10% FBS and allowed to incubate with the cells for 2 h at designated time intervals of 12 h, 24 h, 36 h, and 48 h. Cell viability was evaluated by measuring the absorbance at 450 nm with a spectrophotometer.

qRT-PCR

RNA was isolated from brain tissue samples utilizing the Trizol reagent (Sangon Biotech, China). The concentration of RNA was determined, and 2 μg of RNA was subjected to reverse transcription to generate cDNA. qRT-PCR was carried out using SYBR Green Master Mix (Tiangen, China) according to the following procedure: melting (95 °C, 20 s), annealing (94 °C, 10 s), and elongation (70 °C, 25 s) for 40 cycles. The relative gene expression was determined employing the 2^-ΔΔCt approach. The primer sequences are as follows: GAPDH forward 5'- ATGACCACAGTCCATGCCATC −3' and reverse 5'- GAGCTTCCCGTTCAGCTCTG −3'; IL-1β forward 5'- TCCAGGATGAGGACATGAGCAC −3' and reverse 5'- GAACGTCACACACCAGCAGGTTA −3'; NF-κB forward 5'- ATGGCAGACGATGATCCCTAC −3' and reverse 5'- CGGAATCGAAATCCCCTCTGTT −3'; TNF-α forward 5'- TGCCTATGTCTCAGCCTCTT −3' and reverse 5'- GGAGGCCATTTGGGAACT −3'.

Western Blot

Brain tissue was collected from the region surrounding the injury site, specifically from the cortical area. Protein concentrations were measured using a BCA assay kit (Beyotime Biotechnology, China). Samples were separated by SDS-PAGE and transferred onto PVDF membranes (Millipore, USA), followed by blocking with either 5% skim milk or 5% BSA (Biosharp, China). The membranes were then incubated with primary antibodies overnight. The following day, secondary antibodies were applied for further processing. Protein bands were detected using a GE Imaging System (Amersham ImageQuant 800) and analyzed with ImageJ software. Protein levels were normalized relative to internal reference proteins. The following primary antibodies were used: PI3K (Cell Signaling Technology, 4257 T, 1:1000, USA), phosphorylated PI3K (Cell Signaling Technology, 17366 T, 1:1000, USA), AKT (Cell Signaling Technology, 4691 T, 1:1000, USA), phosphorylated AKT (Cell Signaling Technology, 4060 T, 1:2000, USA), NF-κB (Abcam, AB32536, 1:10,000, UK), phosphorylated NF-κB (Affinity, AF2006, 1:1000, USA), IL-1β (Affinity, AF5103, 1:1000, USA), TREM2 (Abcam, AB305103, 1:1000, UK), Bax (Abcam, AB32503, 1:5000, UK), Bcl-2 (Huabio, JF104-8, 1:2000, China), and β-Actin (Affinity, AF7018, 1:10000, USA).

ELISA

ELISA kits were used to assess the concentrations of IL-1β (Epizyme Biomedical Technology, China) in cell supernatants and TNF-α (Epizyme Biomedical Technology, China) in tissue samples, following the manufacturer’s instructions.

Nissl Staining

Nissl staining was conducted to assess neuronal viability following TBI. After the establishment of the model, mice were sacrificed, and tissue samples were collected, embedded, and prepared for sectioning. Mice underwent perfusion with saline, followed by paraformaldehyde, after which the brain tissue was fixed, dehydrated, and embedded in paraffin. Slides (5–10 μm) were subjected to deparaffinization, rehydration, and subsequently stained with a Nissl staining kit (Beyotime Biotechnology, China). The slides were then scanned and evaluated for neuronal viability.

Hematoxylin and Eosin (HE) Staining

After embedding the brain tissue samples in paraffin and slicing them into sections the samples were first deparaffinized by immersing them in xylene and subsequently rehydrated through a series of graded ethanol and distilled water. The sections were then subjected to staining using the Hematoxylin and Eosin (HE) method. Initially, the sections were stained with hematoxylin (Beyotime Biotechnology, China), followed by washing with distilled water. Following this, the sections underwent differentiation with a 1% hydrochloric acid ethanol solution (Beyotime Biotechnology, China), and were subsequently stained with eosin (Beyotime Biotechnology, China). After staining process, the sections were washed with distilled water, dehydrated through a graded series of ethanol, and cleared with xylene. Finally, coverslips were applied to the sections. The stained samples were then visualized using microscope (Zeiss, Germany) for histological analysis.

Immunohistochemistry

Brain tissue samples were embedded in paraffin and sectioned into 5–10 µm slices. The tissue slices underwent a series of procedures, starting with deparaffinization in xylene, followed by rehydration through a graded ethanol series and then immersion in distilled water. Antigen retrieval was performed by heating the sections in a sodium citrate buffer solution at high temperature. After this step, the sections were permeabilized with 0.1% Triton X-100 (Beyotime Biotechnology, China) for 20 min. After washing with PBS, non-specific binding sites were blocked by incubating the sections with 5% BSA for 1 h at room temperature. Subsequently, the sections were then incubated overnight at 4 °C with the primary antibody (Iba1, AB178846, Abcam, 1:2000, UK). On the following day, the sections received an incubation with the HRP-conjugated secondary antibody for 1 h at room temperature. After this incubation, the immunoreactivity was visualized using a DAB (diaminobenzidine) substrate kit (Boster Biological Technology, China) according to the manufacturer’s instructions. Following DAB staining, the sections were counterstained with hematoxylin to visualize the cell nuclei. Once the staining was completed, the sections were dehydrated through a graded ethanol series, cleared with xylene, and then mounted under coverslips. The stained sections were photographed under a light microscope (Zeiss, Germany).

Immunofluorescence

As previously outlined, brain tissue samples were paraffin-embedded, and sections with a thickness of 5–10 µm were produced. Freshly prepared paraffin sections underwent deparaffinization and rehydration before being subjected to antigen retrieval by heating in sodium citrate buffer at high temperature. Following antigen retrieval, the sections were permeabilized with 0.1% Triton X-100 for 20 min. After washing with PBS, non-specific binding sites were blocked by incubating the sections with immunofluorescence blocking solutions (Beyotime Biotechnology, China) for 1 h. The sections were then incubated overnight with the primary antibody (Iba1, Abcam, AB283346, 1:100, UK). On the following day, the sections were washed with PBS, followed by incubation with the second primary antibody (TREM2, Abcam, AB305103, 1:500, UK) overnight. On the third day, following washing to remove the second primary antibody, the sections were exposed to the appropriate fluorescent secondary antibodies. For double labeling, primary antibodies from different species were selected, and the corresponding species-specific secondary antibodies conjugated to distinct fluorophores were applied. After incubation, the sections were washed and mounted using a DAPI-containing immunofluorescence mounting medium (Beyotime Biotechnology, China). For single immunofluorescence staining, after overnight incubation with the first primary antibody (NeuN, Abcam, AB177487, 1:200, UK), the sections were washed and incubated with the corresponding fluorescent secondary antibody, followed by additional washing and mounting under a coverslip. Fluorescent images of the stained sections were captured using a fluorescence upright microscope (Zeiss, Germany).

Immunofluorescence images were acquired using the same magnification and exposure time for all samples. Regions of interest (ROI) were selected around the TBI injury site and surrounding areas. Data analysis was performed using ImageJ software.

TUNEL Staining

TUNEL (Terminal deoxynucleotidyl transferase dUTP nick-end labeling) staining was performed to assess neuronal apoptosis in brain tissue following TBI. A double-labeling procedure was employed to specifically identify apoptotic neurons, integrating TUNEL staining with a neuronal marker (NeuN, Abcam, AB177487, 1:200, UK). After completing the embedding and sectioning of the tissue, TUNEL staining was performed using an TUNEL staining kit (Beyotime Biotechnology, China) according to the manufacturer’s protocol. The sections were first permeabilized with 0.1% Triton X-100 for 20 min, followed by blocking with an immunofluorescence blocking solution for 40 min. Following the blocking step, primary antibodies (NeuN+) were incubated overnight at 4 °C. The next day, after washing with PBS, sections were incubated with fluorescent secondary antibodies. Subsequently, the tissue sections were incubated with TUNEL reaction mixture containing terminal deoxynucleotidyl transferase (TdT) and CY3-labeled dUTP in a humidified chamber at 37 °C for 1 h. Finally, sections were mounted with a mounting medium containing DAPI for nuclear counterstaining. Staining results were photographed by immunofluorescence microscopy (Zeiss, Germany).

DMC Target Prediction

The two-dimensional configuration of DMC was sourced from the PubChem database and analyzed using Swiss Target Prediction to predict potential targets.

TBI Target Screening

TBI-related targets were identified by querying the OMIM database and combined with GeneCards database to create a database of potential TBI targets.

PPI Network

Possible DMC targets were evaluated with Cytoscape to create a protein–protein interaction (PPI) network, aiding in the recognition of important target interactions.

GO and KEGG Enrichment Analysis

GO and KEGG pathway enrichment evaluations were conducted with DMC and TBI target databases to guide further research.

Statistical Analysis

All experiments were conducted with a minimum of three independent replicates (N ≥ 3). Data are reported as mean ± standard deviation. The experimental data underwent analysis utilizing SPSS 27.0.1 and GraphPad Prism 8. Sample sizes (N) are provided in figure legends. Statistical analyses included the use of unpaired t-tests, one-way ANOVA, and two-way ANOVA, with significance levels set at p < 0.05.