Animals

Male C57BL/6 aged 6–8 weeks (weighing 20–25 g) were enrolled in this study. WT mice were obtained from Hubei Province Center for Animal Experiments, and TIPE2-knockout mice on a C57BL/6 background were generated through the CRISPR-Cas9 system to delete TIPE2 exon 2 by Wuhan Xianran Biotechnology Co., Ltd. (Wuhan, China). gRNA sequence: gRNA1: CTTGTTGGAGGGCGAATGTGG; gRNA2: ACTGGGAAATGACACATCGGG. Littermate controls referred to TIPE2-knockout mice and WT mice were used for experimental analysis. The TIPE2 knockout mice were confirmed by Western blot analysis to ensure the absence of TIPE2 expression in the lung tissues (Fig. 3H). Mice were housed in rooms with controlled temperature, humidity, and 12-h light/12-h dark cycle, and food and water were provided ad libitum. All animals received human care in compliance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals.

Reagents

LPS (#L2630) was acquired from Sigma (St. Louis, MO, USA). TNF-α (#E-EL-M3063), IL-18 (#E-EL-M0730), IL-1β (#E-EL-M0037), IL-1 (#E-EL-M0038) ELISA kits were purchased from Elabscience (Wuhan, China). RIPA lysis buffer (#G2038), DAPI (#G1012), BCA protein assay kit (#G2026) were purchased from Servicebio (Wuhan, China). Primary antibodies: RIPK1 (#3493), RIPK3 (#10,188), MLKL (#37,705), P-MLKL (#37,333), Bcl2 (#15,071), Bax (#2772), NLRP3 (#15,101, CST), GSDMD (#39,754), C-caspase3 (#P42574), TIPE2 (#53,842) were purchased from CST (Danvers, MA, USA). GAPDH (#60,004–1-Ig) was obtained from Proteintech (Wuhan, China), and TRIF (#A13605) was purchased from Abcam Biotech (Cambridge, UK). ZBP1 (#AG-20B-0010), Caspase-8 (#AG-20 T-0138), ASC (#AG-25B-0006), Caspase-1 (#AG-20B-0042) were purchased from Adipogen (San Diego, CA, USA).

Surgical Procedure and Animal Treatment

All surgical procedures were performed after the intraperitoneal injection of pentobarbital sodium (50 mg/kg). The cecum was ligated with 4.0 silk and then punctured twice with a 21 G needle. Finally, the animals received 1 mL of 0.9% saline through subcutaneous resuscitation after cecal ligation and puncture (CLP). Rectal temperatures were maintained at 37 °C during surgery using an incandescent lamp. For each group,6 mice (n = 6) were used. Subsequently, the mice were sacrificed 24 h after surgery for the following studies.

Survival Curve Plotting

After CLP surgery, the mice in each group were observed every 24 h, and the number of deaths and survivors in each group was recorded. The survival rates of each group were calculated, and the survival curve for 7 days was plotted using GraphPad Prism 8.0. To compare the survival curves between groups, Log-rank test was used.

Lung Wet/Dry Weight Ratio

The lower lobe of the left lung was isolated, and residual blood was washed away with physiological saline. The lung tissue was blotted dry with filter paper, weighed, and recorded as the wet weight (W). The lung tissue was then placed in a 60 °C oven for 48 h until fully dried, and the dry weight (D) was recorded.

HE Staining

Mouse lung tissues were fixed in 4% paraformaldehyde for 4 h to overnight. After fixation, the tissues were dehydrated, embedded, and sectioned (thickness: 4–5 μm). Sections were deparaffinized in xylene, rehydrated through a graded ethanol series (100%, 95%, 80%, 70%), and finally rinsed in distilled water. Sections were then stained with hematoxylin for 5–10 min, followed by rinsing in running water until the background staining disappeared. The sections were differentiated in 1% hydrochloric acid-alcohol until the nuclei appeared blue, and then blued in running water or an alkaline solution. Afterward, the sections were stained with eosin for 1–3 min, rinsed in running water to remove excess stain, dehydrated through a graded ethanol series (70%, 80%, 95%, 100%), and cleared in xylene. Finally, the sections were mounted with a neutral balsam mounting medium, covered with a coverslip, and allowed to dry before being observed under a light microscope (Olympus, Japan).

Collection and Analysis of Bronchoalveolar Lavage Fluid (BALF)

Mice were euthanized by cervical dislocation, followed by the insertion of a 22G catheter into the trachea to access the lungs. Pre-cooled phosphate-buffered saline (PBS) was gently instilled into the lungs at a volume of 1–2 mL to avoid lung injury. The BALF was then gently aspirated and collected in sterile tubes. This lavage procedure was repeated three times for collection. The collected BALF was aliquoted into cryotubes and stored at −80 °C. The protein concentration in the BALF was measured using a BCA protein assay kit (Beyotime Biotechnology, Shanghai, China) according to the manufacturer’s instructions. Levels of tumor necrosis factor-alpha (TNF-α), interleukin-18 (IL-18), interleukin-1 (IL-1), and interleukin-1 beta (IL-1β) in the BALF were measured using mouse cytokine ELISA kits (Elabscience, Wuhan, China).

Cell Culture and Treatment

The cell line used in this study was the mouse alveolar macrophage cell line MH-S, purchased from ATCC (CRL-2019).MH-S cells were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin–streptomycin at 37 °C in a 5% CO₂ incubator. When cells reached 70–80% confluence, the medium was removed, and the cells were gently washed with PBS. Trypsin–EDTA was added, and the cells were incubated at 37 °C for 1–3 min until they detached. The trypsin was neutralized with culture medium, and the cells were resuspended and replated at a 1:3 ratio in new culture flasks. To construct TIPE2-overexpressing MH-S cells, the cells were transfected with plasmids carrying TIPE2 overexpression vectors (TIPE2-OE) using Lipofectamine 3000, following the manufacturer’s instructions. After 48 h, the cells were treated with LPS. The mouse TIPE2 overexpression plasmid was obtained from MiaoLingBio (Wuhan, China), and the mouse TIPE2 sequence was sourced from the NCBI database (NM_027206.3). LPS was administered at a dose of 10 μg/mL to induce a sepsis model for 6 h.

ELISA

Cell culture supernatants were collected and centrifuged at 1000 rpm for 20 min at 4 °C to remove debris and cell fragments. The levels of IL-18, IL-1β, and TNF-α in the supernatants were measured using ELISA kits according to the manufacturer’s instructions.

Immunofluorescence

Cells were fixed in 4% paraformaldehyde, permeabilized with 0.1% Triton X-100, and blocked with 5% BSA to prevent nonspecific binding. The cells were then incubated with a primary antibody overnight at 4 °C. After washing with PBS, the cells were incubated with a fluorescently labeled secondary antibody (1:400) for 1 h at room temperature in the dark. After further washing with PBS, the cells were mounted with antifade mounting medium and covered with a coverslip. Samples were observed under a fluorescence microscope.

Flow Cytometry Analysis

Cells were cultured in 6-well plates at a density of 1 × 10^6 cells per well. After LPS treatment, the cells were collected, washed with PBS, and resuspended in 1 × Binding Buffer, adjusting the cell concentration. Annexin V-FITC and propidium iodide (PI) were added to the cells, and the mixture was incubated at room temperature in the dark for 15–30 min. The samples were then analyzed using a flow cytometer, with Annexin V and PI fluorescence signals recorded to distinguish early apoptotic, late apoptotic, and necrotic cells.

Western Blot Analysis

Proteins were extracted from cells or tissue samples using a lysis buffer containing PMSF and phosphatase inhibitors. After lysis, the samples were centrifuged to remove debris, and the supernatant was collected. Protein concentration was measured using a BCA protein assay kit. Protein samples were separated by SDS-PAGE and transferred onto a PVDF membrane. The membrane was blocked to prevent nonspecific binding and then incubated with the primary antibody. After washing, the membrane was incubated with the secondary antibody, and target protein expression was detected using chemiluminescence. Band intensity was quantified using ImageJ software and reported as relative intensity compared to the control.

Statistical analysis

All data were expressed as mean ± standard error of the mean (SEM). MWM training experiments were analyzed using two-way ANOVA for repeated measures followed by Bonferroni correction for multiple testing. Multiple groups were analyzed by two-way ANOVA followed by Bonferroni post-tests. A P value of less than 0.05 was considered significant.