Mouse Model, Diet and Treatment

C57BL/6 J female mice purchased from Charles River (Germany) were housed in a standard animal facility under controlled temperature (22 °C), photoperiod (12 h light/dark cycle), with free access to fresh water and pellet diet (Teklad diet 2016, Envigo). The mice were randomized into 4 groups (n = 12/group), with 4 mice/cage (3 cages per group) and acclimatized to the animal facility for two weeks. At 10 weeks of age, mice were subjected to ovx or sham surgery under anesthesia with isoflurane (Baxter Medical AB), and Meloxicam (Metacam, Boehringer Ingelheim Animal Health Nordics A/S) was given as postoperative analgesic. Mice are coprophagic, and therefore, we did not mix sham and ovx mice or treatments in the same cage. A limitation of this study design is that we cannot rule out cage effects. To reduce the risk of cage effects having an impact on the results, the mice were randomly distributed in 12 different cages with 3 cages/group two weeks before study start. The probiotic strain evaluated was Bifidobacterium longum subsp. longum DSM 32947 (also designated BG-L47®, trademark of BioGaia AB, GenBank accession numbers MZ411576) [22]. The strain was a kind gift from BioGaia AB. The strain is hereafter referred to as BL. The culture conditions for BL have been described earlier (2). BL was kept frozen in 15% glycerol in −80 °C and was diluted daily in the drinking water at a concentration of 6 × 107 colony-forming units (cfu)/ml together with vehicle. Mice were treated with either BL and veh or veh only for five weeks, starting one week after ovx or sham surgery. Veh consisted of 8 mg/ml arabinoxylan Oligosaccharides (AXOS; Carbiotix AB, Lund, Sweden), and 0.01% glycerol was added to water bottles with only veh to compensate for the glycerol content in the frozen aliquots of BL. The following four groups were included in the experiment: Sham Veh, Ovx Veh, Sham BL, Ovx BL. One mouse was removed during the study due to complications from the surgery, ending up with n = 11–12 in the groups. At the end of the study, following 3 h of food withdrawal, blood was taken from the tail tip to determine plasma glucose concentrations using an Accu-Check glucometer (Roche Diagnostics). Then, mice were anesthetized with Ketador/Dexdomitor (Richter Pharma/Orion Pharma), bled from the axillary vein, and thereafter euthanized by cervical dislocation. Blood was allowed to coagulate for at least 30 min at room temperature and centrifuged for 10 min, after which the serum was collected and frozen. Tissues and cecal contents were snap frozen in liquid nitrogen. Bones were excised and fixed in 4% phosphate-buffered paraformaldehyde. Femurs for three-point bending test were frozen at −20 °C. All experimental procedures involving animals were approved by the regional animal ethics committee in Gothenburg (ethics number: 4593/22). The study was performed and reported in accordance with ARRIVE guidelines.

Dual X-ray Absorptiometry (DXA)

Total body BMD, lumbar vertebra (L) 2-L5, fat mass, and lean mass were analyzed using Lunar PIXImus densitometer (Wipro GE Healthcare).

Peripheral Quantitative Computed Tomography (pQCT)

Peripheral quantitative computed tomography (pQCT; XCT Research M, Stratec Medizintechnik GmbH, Germany, resolution 70 µm) [23] was used to analyze the trabecular and cortical compartments of the femur. Briefly, trabecular bone was analyzed in the metaphyseal region of the femur. The scan was positioned in the metaphysis at a distance corresponding to 3% of the total length from the distal growth plate in femur, and the trabecular bone region was defined by setting an inner area to 45% of the total cross-sectional area. The cortical bone was analyzed in the mid-diaphyseal region at 36% of the total length of the bone from the distal growth plate in the femur.

High-Resolution MicroCT (µCT)

High-resolution µCT analyses were performed using Skyscan 1275 scanner (Bruker MicroCT, Aartselaar, Belgium) as previously described [24]. Briefly, the L4 was imaged with an X-ray tube voltage of 40 kV, a current of 200 µA, and a 1 mm aluminum filter. The scanning angular rotation was 180°, and the angular increment was 0.40°. The voxel size was 7 µm isotropically. NRecon (version 2.2.0.6) was used to perform the reconstruction after the scans. The trabecular bone in the vertebral body caudal of the pedicles was selected for analysis within a conforming volume of interest (cortical bone excluded) commencing at a distance of 7 µm caudal of the lower end of the pedicles and extending a further longitudinal distance of 245 µm in the caudal direction.

Biomechanics

The three-point bending test (span length 5.5 mm, loading speed 0.155 mm/s) was made at the mid femur using Instron universal testing machine (Instron 3366, Instron) after soaking the bones in PBS solution for 24 h. Based on the recorded load deformation curves, the biomechanical parameters were calculated from raw data produced by Bluehill universal software v4.25 (Instron).

SCFA

SCFA were measured by using a method based on derivatization of the analytes followed by quantitation by high-performance liquid chromatography tandem mass spectrometry (UHPLC-MS/MS). Briefly, the weighed cecum samples were resuspended in 1 mL water. The samples were derivatized as follows: 10 μL of each sample was added into a microcentrifuge tube followed by the addition of 10 μL 75% methanol, 10 μL 200 mM 3-NPH (3-nitrophenylhydrazine in 75% methanol), and 10 μL 120 mM EDC-6% pyridine (N-(3-Dimethylaminopropyl)-N-ethylcarbidiimide in 75% methanol with 6% pyridine). The resulting mixture was mixed and incubated at room temperature for 45 min with shaking. The derivatization reaction was quenched by the addition of 10 μl of 200 mM quinic acid in methanol, and the samples were mixed and incubated for 15 min at room temperature with shaking. 950 μL of water was added to the samples followed by mixing and centrifugation at 15 000 × g at room temperature for 5 min. 100 μL of each supernatant was then transferred to HPLC vials followed by the addition of 100 μL of internal standard (13–C 3-nitrophenylhydrazine labeled SCFA). Samples were analyzed by using a UHPLC-MS/MS consisting of an ExionLC UHPLC system coupled to a 6500 + QTRAP (both from AB Sciex LLC, Framingham, USA). The analytes were separated in a Phenomenex Kinetex C18 (100 × 2.1 mm, 1.7 μm, 100 Å) column, at 40 °C, by using the following gradient: 0–3 min 0.5% B, 3.00–3.01 min 0.5–2.5% B, 3.01–6.00 min 2.5–17% B, 6.00–10.00 min 17–45% B, and 10.00–13.00 min 45–55% B, followed by washing and re-equilibration of the column. Mobile phase A and B were water and acetonitrile, respectively, and total flow was set to 0.4 mL/min. APCI ionization was used in positive polarity, and the analytes were detected by using optimized MRM-transitions for each analyte and internal standard. A calibration curve covering the range of the analytes in the samples was injected together with the analytes.

DNA Extraction of Cecal Samples

Total DNA was prepared from cecal content using the QIAamp Fast DNA Stool kit (Qiagen, Hilden, Germany) according to the manufacturer’s recommendations for ‘‘Isolation of DNA from stool for pathogen detection’’ with the following modifications: Contents from half a cecum were added to tubes with lysing Matrix E (MP Biomedicals, Eschwege, Germany). After the addition of 1 ml inbibitEX buffer, samples were vortexed for 1 min, heated at 90 °C for 5 min, placed on ice, and then run in tissue lyser II (Qiagen, Hilden, Germany) for 60 s at 25 Hz for three rounds.

PCR Quantification of BL

The abundance of BL in cecum was measured using qPCR of cecal content. Analysis was performed using PowerUp™ SYBR™ Green Master Mix (Applied Biosystems), with primers L47F (ATGGCGATTTCTCCTACCCC) (forward) and L47R (GTACTGGACCATGCGAACCT) (reverse), using StepOnePlus (Applied Biosystems). Run parameters were 15 s at 95 ° C, 15 s at 58 °C, and 1 min at 72 °C. The detection limit was set at 36 cycles, and the BL values were calculated as previously described [22]. For statistical analyses, the values below the detection limit were set to the value of the detection limit.

Serum Analysis

Enzyme immunoassay (EIA) kit was used to measure the bone formation marker procollagen type I N-terminal propeptide (P1NP; Immunodiagnostics Systems, Herlev, Denmark) in serum according to manufacturer’s directives.

Statistical Analyses and Data Availability

GraphPad Prism (v. 10.3.1) was used for all statistical analyses. Where indicated in the figure legend, results are presented as dot plots with lines representing means ± SEM. The overall effect of treatment (veh/BL), surgical procedure (sham/ovx), and their interaction were calculated using two-way ANOVA. The non-parametric Mann–Whitney U test was used to compare results from the BL PCR test since data were not normally distributed.

The data that support the findings of this study are available from the corresponding author upon reasonable request.