Cell culture experiments

Established cell lines (A375, ATCC CCL-1619; B16F10, ATCC CRL-6475) were maintained in DMEM (Gibco) supplemented with 10% fetal bovine serum (FBS)(Cellmax). Cells are cultured in a constant temperature incubator with 5% CO2 and 37℃ conditions.

Cell counting kit-8 assay

After the cells fully adhere to the wall, the supernatant was removed using a suction pump and different concentrations of CPT were added. After 24 h of cultivation, added the prepared alkaline medium containing 0.5 mg/mL MTT (Bioroxx, 334Gr001). After further cultivation at 37 °C for 4 h, 150 μL dimethyl sulfoxide was added to each well. Shaked the plate on a vibration table for 10 min. Then placed it in a microplate reader (BioTek) to measure the absorbance at 490 nm.

Cell apoptosis and proliferation detection

BeyoClick™ EdU-555 Cell Proliferation Detection Kit (Beyotime Biotechnology, C0075S) was used to detect cell proliferation. Cells were pretreated with CPT. Followed the instructions for operation to observe and counted the EDU-positive cell rate under a fluorescence microscope (olympus, Stemi 2000C). The Beyotime Biotechnology (C1062M) assay kit was used for detecting cell apoptosis using membrane associated protein V-FITC. After cell administration, followed the instructions and used flow cytometry to detect the samples (C6, BD).

Cell cycle experiment

The Cell Cycle and Apoptosis Detection Kit (C1052) were used to detect cell cycle. Followed the instructions for operation. Then added the newly prepared propidium iodide staining solution, leaved it in the dark at 37 °C for 30 min, and analyzed the DNA content using flow cytometry.

Colony-formation assay

Transfected cells were collected and seeded into a 6-well plate with 200 cells/well. After conventional culture for 2 weeks, the culture was terminated when visible clones appeared in the 6-well plate. After PBS washing for two times, the cells were fixed by 4% methanol for 20 min, and then stained by 0.1% crystal violet for 15 min. The images were observed under an inverted phase contrast microscope (Stemi 2000C, Olympus) and the colonies were counted.

Detection of metabolites

Cells underwent pre-treatment with drugs. Collected cells and added 500 µL of 75% methanol MTBE (9:1, v/v) containing 1,2-13C2 myristic acid (5 µg/mL) stored at − 20 °C per well. Collected cells into a 1.5 mL centrifuge tube using cell scraping and repeated freeze–thaw three times. Afterwards, centrifuged the sample and transferred 500 µL of the supernatant into a new 1.5 mL centrifuge tube. Used a vacuum concentrator to evaporate the sample at 45 °C. After the sample was evaporated, it was subjected to derivatization treatment. Joined 30 µL prepared methoxypyridine (w/v, 10 mg/mL), vortex for 5 min, and shaked for 1.5 h at 30 °C. Then added another 30 µL BSTFA (1% TMCS), vortex for 5 min, shaked for 0.5 h at 37 °C. After derivatization, the sample was centrifuged at 18,000 rpm at 4 °C for 10 min for subsequent loading. Sample analysis was performed using GC–MS (Trace 1310/TSQ 8000), and sample separation was performed at TG-5MS (30 m × 0.25 mm, 0.25 µm) on a capillary column.

ECAR and OCR detection

Extracellular acidification rate (ECAR) and oxygen consumption rate (OCR) were examined using Seahorse XF Glycolysis Stress Test Kit and Seahorse XF Cell Mito Stress Test Kit, respectively. Briefly, 1 × 104 cells per well were seeded into a Seahorse XF 96-cell culture microplate. On the day before boarding, added 200 µL of hydration solution to the lower layer of the XF96 Extracellar Flux Assay Kits. Placed it in a 37 °C CO2 free incubator for hydration overnight. Prepared the required drugs and hippocampal XF base medium, adjusted the pH value to 7.4 ± 0.1, and placed them in a 37 °C water bath for 1 h during use. On the second day, the cells were washed twice with water soaked hippocampal XF base medium. Finally, 175 µL of hippocampal XF base medium was added to each well and incubated at 37 °C in a CO2 free incubator for 1 h. Diluted the drug and added it to the upper layer of XF96 Extracellar Flux Assay Kits, with 25 µL added to each well before use. 30 min later, took out the lower layer of XF96 Extracellular Flux Assay Kits and replaced it with a cell plate that has been incubated for 1 h in a CO2 free incubator at 37 °C, and detected it on the Seahorse instrument.

Pruvate, lactate, glucose uptake and ATP detection

Collected cells into a centrifuge tube and placed them in a tissue grinder for mechanical grinding. After grinding, centrifuged at 2500 rpm for 10 min, took the supernatant and operated according to the instructions of the pyruvate, lactate and glucose detection reagent kit. Then detected the OD value in a microplate reader (BioTek). Collected cells and used ATP to detect the lysate to lyse cells on ice for 30 min. Afterwards, centrifuged at 12,000 rpm for 5 min to remove the supernatant. Followed the instructions of the ATP detection kit and detected the chemiluminescence value in a microplate reader (BioTek).

RNA extraction, PCR and real-time quantitative PCR

Total RNA was isolated from cells using Trizol and cDNA was synthesized using the HiScript® III-RT SuperMix kit (Vazyme, R323-01). The cDNA samples were subjected to a real-time quantitative polymerase chain reaction (RT-qPCR) using the ChamQ Universal SYBR qPCR Master Mix (Vazyme, Q711-02) performed on an ABI 7500 Sequence Detection System (Thermo Fisher). The primer sequences were listed as follow.

ACTB

Forward

GGCTGTATTCCCCTCCATCG

Reverse

CCAGTTGGTAACAATGCCATGT

HK2

Forward

ATGATCGCCTGCTTATTCACG

Reverse

CGCCTAGAAATCTCCAGAAGGG

PFKFB3

Forward

TCTGGATGCCGTACAGCAATG

Reverse

GTGTCGGACAGTTAGTCATGC

PKM2

Forward

CGCCTGGACATTGACTCTG

Reverse

GAAATTCAGCCGAGCCACATT

LDHA

Forward

CAAAGACTACTGTGTAACTGCGA

Reverse

TGGACTGTACTTGACAATGTTGG

MCT4

Forward

CACGGGTTTCTCCTACGCC

Reverse

GCTGTAGCCAATCCCAAACTC

Cell extracts and western blot analysis

Proteins were collected from cells and mice tissues by using RIPA lysis buffer. After separation by SDS-PAGE, proteins were transferred to PVDF membranes and detected with specific antibodies. Antibodies specific for anti-HK2 (ABclonal, A0994), anti-PFKFB3 (ABclonal, A3934), anti-AMPK (ABclonal, A1229), anti-p-AMPK (ABclonal, AP1002), anti-HIF-1α (ABclonal, A22041), anti-PKM2 (Abcam, ab89364), anti-LDHA (Affinity, DF6280), anti-MCT4 (Affinity, AF5253), and anti-β-actin (Affinity, AF7018) were used. The relative protein expression was determined by an imaging system (ChemiDoc TM XRS+, Bio-Rad).

Immunofluorescence

Tumor spheroids were placed in 4% paraformaldehyde and then processed with Triton X-100 for 20 min and incubated respectively with 5% bovine serum albumin and anti-PFKFB3 (ABclonal, A3934) and anti-p-AMPK (ABclonal, AP1002) antibody overnight. Next day, the spheroids were rinsed thrice and cultivated in secondary antibodies (Invitrogen, Alexa flour-594, Invitrogen) for 2 h at indoor temperature. The cell nucleus was used by using Hoechst33342 (Beyotime, 1810898). Images were acquired using a confocal microscope (Zeiss, Vert.A1).

Immunohistochemical and TUNEL

Mouse xenograft primary tumors and lung tissues were paraffin-embedded and sectioned by routine techniques. Deparaffinization and rehydration of tissue sections were first achieved. Heat-induced antigen retrieval was done using Decloaker solution for 15–20 min (Biocare Medical, RD913L). Tissue sections were blocked with TBS/10% NGS, then incubated with primary antibody overnight, followed by Dako envision plus kit and DAB staining. All samples were counterstained with hematoxylin. Samples were photographed using a multifunctional pathological imaging system (PerkinElmer, Mantra 1.0.1).

The pre-treatment was the same as before. Used TUNEL reagent kit for component staining. Subsequently, according to the manufacturer’s instructions, TUNEL was performed using the in situ cell death detection kit (Roche, Penzberg, Germany). Afterwards, took photos using a fluorescence microscope (Zeiss, Vert.A1).

Si-RNA interference

Si-RNA against human AMPK (EKBIO) were introduced into cells by lipid mediated transfection using si-RNA transfection medium, reagent and duplex (Santa Cruz biotechnology) following manufacturer recommendations. Briefly the day before transfection cells were platted at 2.5 × 105 cells per well in 2 mL antibiotic-free normal growth medium supplemented with FBS. Cells were incubated until they reach 60–80% confluence. The duplex solution containing the si-RNA was then added to the cells. After 5 to 7 h, antibiotic were added in each well and the cells were incubated for 24 h more. The media was then replaced by normal growth media and cells were used for experiments and assayed by western blot to analyze the expression of AMPK.

Tumor graft models in mice

The allograft tumor model was made using B16F10 cells in male C57BL/6N mice (4–5 weeks old, obtained from Shanghai Slac Laboratory Animal CO.LTD). Adjust the concentration of B16F10 cells to 1.5 × 106/mL. Inoculate 0.1 mL of cell suspension under the right back skin of male mice. After about two weeks, the protruding tumor tissue on the back of the mice can be clearly observed, and the mice will be randomly divided into groups. On the second day after grouping, medication was administered by gavage at a volume of 0.1 mL/10 g, while the model group was given an equal amount of olive oil. The length and width of the solid tumor were measured every two day using the caliper. At 14-day post-treatment, all mice were sacrificed, the tumor tissues were collected for corresponding assays. The tumor volume was calculated according the formula length × width2 × 0.52. The xenograft tumor model was repeated using A375 cells in male BALB/c nude mice (4–5 weeks old, obtained from Nanjing Biomedical Research Institute of Nanjing University).

Statistical analysis

All data are expressed as the mean ± standard deviation (s.d.), and the number of samples is indicated in each figure legend. The statistical significance of differences was assessed using the Student’s t-test or Spearman correlation analysis. Results shown are representative of at least three independent experiments. Differences reached statistical significance with *P < 0.05, **P < 0.01 and ***P < 0.001. Statistical computations were performed using Prism software (Graph Pad).