Antibodies and reagents

All antibodies used were rabbit polyclonal unless specified. Commercially available antibodies: GAPDH (Abcam), PARP12 goat polyclonal (Abcam) (IF: 1:200), PARP12 (Sigma Prestige Antibody), 6X His-Tag mouse monoclonal (Invitrogen), GST mouse monoclonal (Abcam), HA mouse monoclonal (New England Biolabs), p53 mouse monoclonal (DO-1) (Santa Cruz; IP 2 µg/1 mg lysate), anti-Golgin-97(1:2,000) (kindly provided by Dr. Antonella De Matteis-TIGEM-Pozzuoli, Naples), MAVS (IF: 1:400), HA- Rabbit monoclonal (C29F4), total AKT [IP: 1:100 (v/v); IF: 1:100)], total AKT mouse monoclonal (clone 40D4; IF:1:200), γH2A.X (phospho-S139) mouse monoclonal (N1-431, Abcam, IF: 1:500), Poly-Mono-ADP-Ribose rabbit monoclonal (E6F6A), PARP1, Bim, pAKT (T308), pAKT (S473), pFOXO1 (S256), total FOXO1, p53 mouse monoclonal (IF: 1:200), β-actin mouse monoclonal, normal IgG mouse. All the above antibodies were purchased from Cell Signalling Technology unless otherwise specified. For WB, all primary antibodies were diluted 1:1000, except for GAPDH, 6X-His Tag, GST, β-Actin (1:10,000), p53 (DO-1) (1:500) and HA (1:4,000). HRP-conjugated secondary antibodies were purchased from Calbiochem and used 1:5,000 final dilution; Alexa Flour-488, -568 and -647 conjugated secondary antibodies for immunofluorescence were purchased from Molecular Probe and used 1:400 final dilution. AKT inhibitor MK-2206 was purchased from Selleckem. Olaparib, Protein A-Sepharose CL-4B (GE17-0780–01, Cytiva). PJ-34 Hydrochloride Hydrate, PhosoStop (phosphatase inhibitor cocktail), cOmplete (TM)#ULTRA Tablets (protease inhibitor cocktail), Glutathione Sepharose 4B, Immobilon Crescendo Western HRP Substrate, mPAGE™ Bis–Tris Precast Gel 8%,10%, 4–12% were purchased from Merck Millipore. IMMOBILON-P, Protran Pure Nitrocellulose Membrane [45 µm] was from Revvity.

Cell cultures and transfection

MCF7 cell line was purchased from European Collection of Authenticated Cell Cultures (ECACC), MCF10A, MDA-MB-231, PC3 cell lines were purchased from the American Type Culture Collection (ATCC). ZR-75-1, MDA-MB-468 and HCT-116 cell lines were kindly provided by dr. Nunzio Antonio Cacciola (Federico II University of Naples, Italy), HepG2 cell lines were originally obtained from the laboratory of Dr. Alberto Luini (IEOMI, National Research Council, Naples, Italy). MCF7, MDA-MB-231 and HepG2 cells were cultured in DMEM medium. The cell lines ZR-75-1, MDA-MB-468, HCT-116 cells were grown in RPMI medium, while PC3 cells were cultured in DMEM-F12 medium. All the media listed above were supplemented with 10% (v/v) FBS, 2 mM L-glutamine. MCF10A cells were cultured in DMEM-F12 media supplemented with 5% horse serum, 20 ng/ml epidermal growth factor, 500 ng/ml hydrocortisone, 100 ng/ml cholera toxin, 10 μg/ml insulin and 2 mM L-glutamine. All the above supplements and media were purchased from GibcoTM. All cell lines were cultured in a 37 °C and 5% CO2 incubator. The AKT wild-type or its mutant constructs were transiently transfected using Lipofectamine LTX Reagent with PLUS Reagent (Invitrogen) in Opti-MEMTM medium (GibcoTM). The cDNA for the reaction was used at a concentration of 6 μg for WT and M4 AKT, 7.2 μg for M1, M2, M5, 5.5 µg phospho-MUT AKT. The cells were then incubated for 24 h, in the same growth conditions. For RNA interference, commercially available siRNA oligos targeting hPARP12 (Dharmacon) were used at a concentration of 50 nM in Opti-MEM™ medium and transfected with Lipofectamine™ RNAiMAX Transfection Reagent (Invitrogen) for all cell lines, except HepG2 and HCT116, where Oligofectamine was used as transfection reagent. To transiently knock down human p53, cells were transfected with a p53 siRNA (5′-GGAAAUUUGCGUGUGGAGU-3′) as previously described [19]. MCF10A cell line was transfected using 100 nM of hPARP12 siRNA oligos. The cells were then incubated for 24 h, 48 h, 72 h in normal growth conditions. The efficiency of the interference was assessed by western blot analysis. For PARP12 knock-down experiments, 2 × 106 MCF7 cells were plated in 100 mm of diameter cell culture plates and PARP12 siRNA transfection performed for 48 h before performing immunoprecipitation assay of endogenous p53. In all the other cases, PARP12 knock-down was performed when cell confluence was in the range of 50% to 70%, independently of the cell line.

Flow cytometry

MCF7 cells were seeded into 6 well plates (3 × 105 cells). After overnight (ON) incubation at 37 °C, the cells were transfected or not with PARP12 siRNAs for 24 h, 48 h and 72 h. Trypsinised cells were pelleted, washed in ice-cold PBS, resuspended in ice-cold ethanol (while vortexing) and then incubated overnight at −20 °C. Then, the samples were centrifuged at 500×g for 5 min, the ethanol was removed, and the cells were washed in ice-cold PBS and incubated with 50 μg/ml propidium iodide for 30 min in the presence of 200 μg/ml RNAse A. The cells were then analysed using the Becton Dickinson (BD) FACS-CantoA instrument. Data are means ± SD of three independent experiments.

Apoptotic assay

Apoptosis-mediated cell death of MCF7 cells was examined at 48 h and 72 h following PARP12 siRNAs transfection by double staining with the Annexin V-FITC kit (Miltenyi Biotec GmbH), according to the manufacturers’ instructions. Data are means ± SD of three independent experiments.

Real-time apoptosis acquisition

Incucyte SX1 Live-Cell Imaging system (Sartorius) was used for kinetic monitoring of apoptotic activity of MCF7 cells. Approximately 2 × 104 MCF7 cells were plated onto a 48-well plate and transiently transfected with PARP12 siRNAs (50 nM), AKT constructs (125 ng for WT and M3 and 100 ng for phospho-MUT) or treated with the AKT inhibitor MK-2206 (500 nM). After 4 h from the treatments, the Incucyte Annexin V NIR Dye (Sartorius, 4768) was added to the growth media at a final concentration of 1:400 and cells maintained at 37 °C and 5% CO2 for up to 72 h. Phase images were acquired every 4 h (Objective: 20 X; Scan type: standard, 4 images per well; channel selection: Phase Contrast and NIR). The results were analysed using Incucyte software, where the red area (apoptotic cells)/phase area ratio was normalized to T0 for each well at each time point. Quantified time-lapse curves were generated by the software. Each experiment was performed in triplicate to ensure reproducibility.

Quantitative real-time PCR

Total RNA was extracted from MCF7 cells buy using RNAeasy Mini Kit (Qiagen) according to the user manual. One μg of RNA was retro-transcripted by using QuantiTect® Reverse Transcription Kit (Qiagen) according to manufacturer’s instructions; cDNAs were used to perform q-PCR on Light Cycler 480 Instrument II (Roche) by using LightCycler 480® SYBR Green I Master (Roche) mix, according to manufacturer’s instructions to assess the relative abundance of AKT1 (hAKT1 fw: 5′- AGTTCTCCTACTCGGCCAG-3′; hAKT1 Rv: 5′- AATACAGATCATGGCACGAGG -3′) AKT2 (hAKT2 Fw: 5′- CCAAATTCCAGTACAGACCCAG-3′; hAKT2 Rv: TTCTAACCAAACGCTCAGGAG-3′) and AKT3 (hAKT3 Fw: CATCACCAGTCCTAGCTCTTAC-3′; hAKT3 Rv: 5′- ATGAGGGTGAAAGGTGGC-3′) transcripts. Values were normalized to the expression of reference gene GAPDH (GAPDH Fw: 5′- AGTTAAAAGCAGCCCTGGTGAC-3′; GAPDH Rv: 5′- CCACATCGCTCAGACACCAT-3′). Relative quantification analysis was conducted by using 2-ΔCt method.

Softwares

The bioinformatic tool ADPredict, available online at www.adpredict.net, was used for the prediction of ADP-ribosylated acidic residues (aspartic and glutamic acids). Residues with the highest score were considered for subsequent mutagenesis analysis.

Databases

The correlation between breast cancer gene expression and survival rate was analysed through the bioinformatic tool Kaplan–Meier plotter (https://kmplot.com/analysis/).

Site-directed DNA mutagenesis and molecular cloning

Human-AKT1 E91Q, E132Q/E133/Q/E135Q, E298Q/D302N, E375Q, E397Q/D398N mutants were generated by site-directed mutagenesis reactions using the following primers:

hAKT1 E91Q Fw: 5′-CCTTCCATGTGCAGACTCCTGAGG-3′;

hAKT1 E91Q Rv: 5′- CCTCAGGAGTCTGCACATGGAAGG-3′;

hAKT1 E132Q/E133Q/E135Q Fw: 5′-GACAACTCAGGGGCTCAACAGATGCAGGTGTCCCTGGCCAAG-3′;

hAKT1 E132Q/E133Q/E135Q Rv: 5′-CTTGGCCAGGGACACCTGCATCTGTTGAGCCCCTGAGTTGTC-3’;

hAKT1 E298Q/D302N Fw: 5’-CTTCGGGCTGTGCAAGCAGGGGATCAAGAACGGTGCCACCATGAAG-3′;

hAKT1 E298Q/D302N Rv: 5′- CTTCATGGTGGCACCGTTCTTGATCCCCTGCTTGCACAGCCCAAG-3′;

hAKT1 E375Q Fw: 5′-GCACGCTTGGTCCCCAGGCCAAGTCCTTG-3′;

hAKT1 E375Q Rv: 5′-CAAGGACTTGGCCTGGGGACCAAGCGTGC-3′;

hAKT1 E397Q/D398N Fw: 5′- CTTGGCGGGGGCTCCCAGAACGCCAAGGAGATC-3′;

hAKT1 E397Q/D398N Rv: 5′-GATCTCCTTGGCGCTTCTGGGAGCCCCCGCCAAG-3′;

hAKT1 T308A Fw: 5′-GGTGCCACCATGAAGGCCTTTTGCGGCACAC-3′;

hAKT1 T308A Rv: 5′-GTGTGCCGCAAAAGGCCTTCATGGTGGCACC-3′;

hAKT1 S473A Fw: 5′-CACTTCCCCCAGTTCGCCTACTCGGCCAGCG-3′;

hAKT1 S473A Rv: 5′-CGCTGGCCGAGTAGGCGAACTGGGGGAAGTG-3′.

hAKT1 T308A Fw: 5′-GGTGCCACCATGAAGGCCTTTTGCGGCACAC-3′.

hAKT1 T308A Rv: 5′-GTGTGCCGCAAAAGGCCTTCATGGTGGCACC-3′.

hAKT1 S473A Fw: 5′-CACTTCCCCCAGTTCGCCTACTCGGCCAGCG-3′.

hAKT1 S473A Rw: 5′-CGCTGGCCGAGTAGGCGAACTGGGGGAAGTG-3′.

PCR reactions were performed using PfuTurbo Cx Hotstart DNA Polymerase (Agilent) according to the manufacturer’s instructions. The mutagenesis reaction products were cloned in pCDNA.3xHA (a gift from M. Santoro, Federico II University, Naplesi) plasmid and transformed in TOP10 chemical competent cells (Invitrogen). The constructs encoding the fusion proteins between hAKT wild-type or its mutants were cloned into the EcoRI/XhoI sites of pET28b prokaryotic expression vector (Novagen) and expressed in BL21(DE3) chemically competent cells for the expression and purification of the corresponding N-terminally His-tagged AKT proteins.

Expression and purification of his-tagged AKT proteins from inclusion bodies

BL21(DE3) pLysS cells were transformed with plasmid encoding His-tagged AKT1(pET28dAKT1). The bacterial cultures were grown at 37 °C under continuous shaking (200 rpm), monitoring the OD600 till it reached 0.5. Bacteria were then induced with 0.3 mM IPTG at 20 °C. After ON incubation, the cultures were chilled on ice and centrifuged at 5,000 × g for 10 min at 4 °C. The pellets were subsequently resuspended in lysis buffer (10 mM Tris 7.5, 5 mM EDTA, 100 mM NaCl supplemented with protease and phosphatase inhibitors) incubated at room temperature (RT) for 20 min and then sonicated on ice in a falcon tube for 5 min (pulse: 10 s off, 30 s off, amplitude: 40%). 1% Triton X-100 was added to the homogenized lysates, and incubated on a rotor wheel for 30 min at 4 °C. Lysates were clarified by centrifugation at 10,000 rpm, 4 °C, resuspended in lysis buffer, homogenized using a small potter and furtherly centrifugated. The pellet was washed twice with wash buffer supplemented with urea (10 mM Tris 7.5, 5 mM EDTA, 5 mM DTT, 100 mM NaCl, 2% (v/v) Triton X-100, 2 mM Urea) followed by one wash in the same buffer without urea and triton. The pellet was resuspended in urea buffer (8 M Urea, 100 mM Tris 7, 5 mM EDTA, 100 mM DTT supplemented with protease inhibitor cocktail) under stirring conditions first at RT and then subsequently left overnight at 4 °C. Following day, the pellet was discarded after centrifuging for 30 min at 18,000 rpm. Concentration of the supernatant or the inclusion bodies were estimated. To refold, the inclusion bodies were diluted in dilution buffer (100 mM Tris 7.5, 5 mM EDTA, 1 mM GSH, 0.3 mM GSSG, 500 mM L-Arginine); gradually adding the buffer at a time to reach a final concentration of the protein to 200 μg/mL. The diluted inclusion bodies were left under stirring at 15 °C for ON to subsequently centrifuge at 18,000 rpm for 30 min and then the supernatant was recovered. After estimating the protein concentration, dialysis was performed against 2L dialysis buffer (100 mM Tris 7.5, 150 mM NaCl, 1 mM EDTA, 10% (v/v) Glycerol) ON and subsequently the protein was concentrated on Vivaspin 6 (with a molecular weight cut-off of 10 kDa), centrifuging for 4 hat 3,260 rpm.

Clonogenic assays

MCF7 cells were seeded in 6-well plates (10,000 cells/ well). Following day, the cells were transiently transfected or not with PARP12 siRNAs. The cell colony growth was monitored for 10 days till the individual colonies did not merge. Subsequently, the cells were washed in PBS thrice and then fixed with 4% paraformaldehyde for 5 min. The colonies were then stained with 1% (w/v) crystal violet for 30 min. The stained colonies were by diluting them in 30% (v/v) acetic acid and collecting the cells into a 96-well plate to subsequently quantify their absorbance of crystal violet at 590 nm. Absorption measurements were normalized to the amount of crystal violet released from the control cells.

Immunoprecipitation and immunoblotting

MCF7 cells were transiently transfected or not (Mock) with PARP12 siRNAs with Lipofectamine RNAiMAX Reagent for 48 h or cDNAs coding for HA-tagged wild-type or AKT1 point mutants’ constructs using Lipofectamine LTX and Plus reagent for 24 h.

For endogenous AKT immunoprecipitation, MCF7 cells were washed twice with ice-cold PBS 1X and lysate in CHAPS Lysis Buffer [0.3% (w/v) CHAPS, 40 mM Hepes pH 7.4, 2 mM EDTA supplemented with protease and phosphatase inhibitors]. Total lysates were passed 10 times through a 25-gauge needle with syringe, kept at 4 °C for 20 min. Lysates were clarified by centrifugation at 13,000 rpm for 10 min. Supernatants were collected and protein concentration quantified using Bradford protein assay, according to manufacturer’s instructions (Biorad). Two mg of total lysates were incubated with AKT antibody or with normal Rabbit IgG (Pre-im-IgG) on rotation for 2 h at 4 °C. Following antibody incubation, protein A Sepharose CL-4B, previously equilibrated in CHAPS Lysis Buffer, was added to the mixture and incubated on rotation for 1 h at 4 °C. The beads were washed three times with CHAPS lysis buffer supplemented with 150 mM NaCl and two times in WASH Buffer [50 mM Hepes pH 7.4, 40 Mm NaCl, 2 mM EDTA].

For endogenous p53 immunoprecipitation, MCF7 cells were washed twice with ice-cold PBS 1X and lysed in RIPA buffer [100 mM Tris–HCl pH 7.5, 1% IGEPAL (w/v), 0,5% Sodium Deoxycholate (w/v), 0,1% SDS (w/v), 150 mM NaCl supplemented with protease and phosphatase inhibitors] on rotation at 4 °C for 30 min. Lysates were clarified and quantified as described above. One or 1,5 mg of total lysates were incubated with p53 DO-1 mouse monoclonal (1 µg/mg), or with normal mouse IgG (Pre-Im-IgG) on rotation overnight at 4 °C. Following antibody incubation, protein A Sepharose CL-4B, previously equilibrated in RIPA buffer, was added to the mixture and incubated on rotation for 1 h at 4 °C. The beads were washed three times with lysis buffer and two times with tris HCl pH 7.4. The protein complexes were eluted from the beads by using SDS sample buffer. For immunoblotting, 20 μg of total cell lysate and the eluted immunoprecipitated proteins were run on SDS/PAGE and immunoblotted with primary antibodies, diluted in 5% BSA in TBS-Tween (0,1% v/v). All densitometric analysis were performed using the Image J software and normalised for total protein levels.

Immunofluorescence and confocal microscopy

Cells were fixed with 4% paraformaldehyde for 10 min at RT, washed three times in PBS, incubated for 7 min at RT in 0,1% Triton in PBS and then incubated for 30 min at RT in blocking solution (0.5% bovine serum albumin, 50 mM NH4Cl in PBS, pH 7.4, 0.1% saponin and 0.02% sodium azide). Cells were subsequently incubated with the indicated antibodies diluted in blocking solution for ON at 4 °C. After incubation with the primary antibody, cells were washed three times in PBS and incubated with a fluorescent-probe-conjugated secondary antibody, for 30 min at RT. Alexa Fluor 488-, 568- or 647 conjugated anti-rabbit, anti-mouse or anti-goat donkey antibodies were used at a dilution of 1:400 in blocking solution. After immunostaining, cells were washed three times in PBS and twice in sterile water. The coverslips were then mounted on glass-microscope slides with Mowiol. Images were taken using a Zeiss-LSM 980 confocal microscope. Optical confocal sections were taken at 1 Air Unit. Quantitative analysis was performed using the Image J software. In brief, for γH2AX, it was measured the percentage of cells showing nuclear staining. For p53 nuclear staining, the Nuclear/Cytoplasmic ratio was calculated by measuring the relative fluorescence integrated intensities in the nuclear and cytoplasmic areas. The cytoplasmic area was defined using AKT staining, which served as a marker for the total cell area.

Proximity ligation assay

Proximity ligation assays were performed using the Duolink anti-goat MINUS (DUO92006) and anti-Rabbit PLUS (DUO92002) in situ PLA probes and the Duolink in situ Detection Reagents Red (Sigma-Aldrich), following the manufacturer’s instructions. The amplified signals were acquired using laser scanning confocal microscopy and analysed with the Image J software. In brief, the PLA puncta were identified as objects with a signal above a minimum threshold and quantified as number of PLA puncta/cell.

Af1521 macro domain-based pull-down assay

MCF7 were transiently transfected or not to follow the ADP-ribosylation of overexpressed HA-tagged or endogenous AKT. Post transfection, cells were lysed or solubilized following the same protocol described above. The supernatants were recovered, and the protein concentration was evaluated using the BCA Protein Assay Kit (Thermo Fisher Scientific). The total cell lysates (1–1.5 mg) were further incubated with 46 μg GST-tagged- macro domain, as previously described [5, 20].

In vitro ADP-ribosylation assay

One μg of purified His-tagged, full-length AKT1 (wild-type or relative point mutants) was incubated with 250 ng GST-tagged catalytic fragment of GST-tagged PARP12 in ADP-ribosylation buffer (50 mM Tris–HCl pH 7.4; 4 mM DTT; 500 μM MgCl2; 100 μM NAD+), at 37 °C for 60 min. At the end of the incubation, the reaction was stopped by adding SDS sample buffer.

GST-pull down assay

GST pull-down assays were carried out as previously described [21], with some modifications. Briefly, 3 μg of purified His-tagged AKT were incubated with 300 ng GST-tagged PARP12 catalytic fragment in ADP-ribosylation buffer at 37 °C for 60 min. Then, 30 μl glutathione sepharose beads were added in GST incubation buffer (50 mM Tris, pH 8.0, 100 mM NaCl, 0.2% Triton X-100, protease inhibitors) for a further incubation on rotation for 1 h at 4 °C. The beads were then washed three times with GST incubation buffer, recovered by centrifugation (750 g, 5 min at 4 °C) and further washed two times with the same buffer without Triton X-100. The bound protein was eluted from the glutathione sepharose beads with GST elution buffer (100 mM Tris, pH 8.0, 20 mM glutathione, 5 mM dithiothreitol). The 10% and 80% of the input and eluted proteins, respectively, were processed for 8% SDS/PAGE and western blotting analysis.

Statistics and reproducibility

All of the quantified western blots are the mean ± SEM or mean ± SD, as indicated in figure legends, of at least three independent experiments. Quantitative analysis was performed using the Image J software. For statistical analysis, p-values were calculated from at least three experiments, comparing control and each treated group individually using Student’s t-test. All statistical parameters are listed in the corresponding figure legends. For all statistical tests, P < 0.05 was considered significant and is indicated by asterisks. For vitality assays, One-way ANOVA multiple comparisons test and Student’s t-test were applied using the GraphPad Prism 7 software. P-values < 0.05 were considered significant.